Everything below concerns pentadecapeptide. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2026-07-31. Where a claim depends on a specific study, the study is described rather than over-claimed.
Confirmation of identity and purity relies on standard peptide analysis techniques. Reverse-phase high-performance liquid chromatography separates the peptide from related impurities and serves as the most common purity assay. Mass spectrometry, often coupled to that chromatography step, provides an accurate molecular mass that can be matched against the expected value. Amino acid analysis or sequencing can be added for further confirmation. Because short peptides can be produced by different synthetic routes, laboratories usually report both a chromatographic purity percentage and a mass confirmation rather than a single figure.
BPC-157 is commonly supplied as a lyophilized powder, a freeze-dried solid that is reconstituted before use in laboratory work. As a short peptide, it dissolves readily in water and in aqueous buffer solutions, and stock solutions are typically prepared in water or a mild buffer. The chain contains several proline and acidic residues, which influence how it behaves in solution. Because the solid can take up moisture, weighing and handling are usually performed under low-humidity conditions. Its solubility class is described as freely soluble in water rather than requiring an organic solvent.
Once dissolved, the material is considerably less stable than the dry solid. Aqueous solutions are usually kept cold and used within a short window, and neutral or mildly acidic buffers are preferred over strongly alkaline conditions. Freeze-thaw cycles promote aggregation and loss of material to container surfaces, so dividing a batch into single-use aliquots is standard. Adsorption to plastic and glass can lower the measured concentration, meaning solution strength may need rechecking before an experiment.
Identity and purity are established with complementary methods rather than one test. Reverse-phase high-performance liquid chromatography separates the main peak from deletion sequences and oxidized variants, and its area percentage is the usual purity figure. Mass spectrometry confirms the expected molecular mass and can flag truncations or modifications that chromatography alone might miss. Amino acid analysis and peptide mapping add sequence-level confirmation, while residual counter-ion and water content are measured separately.
| Property | Value | Notes |
|---|---|---|
| Physical form | Lyophilized powder | Freeze-dried solid, often hygroscopic |
| Solubility class | Freely soluble in water | Aqueous buffers used for stock solutions |
| Storage, dry powder | Minus 20 °C or colder | Recommended for long-term retention |
| Storage, solution | 2–8 °C or frozen | Avoid repeated freeze-thaw cycles |
| Typical analytical method | RP-HPLC with mass spectrometry | Purity percentage plus mass confirmation |
BPC-157 is a synthetic pentadecapeptide, meaning it consists of fifteen amino acids joined in a single chain. Its sequence is Gly-Glu-Pro-Pro-Pro-Gly-Lys-Pro-Ala-Asp-Asp-Ala-Gly-Leu-Val, a fragment corresponding to part of a larger protein found in human gastric juice. The peptide was first described in the 1990s by researchers in Zagreb who were studying gastric protective factors. It is not a naturally circulating hormone; it is a laboratory-made fragment derived from a stomach protein. The name is an abbreviation of body protection compound, with the number referring to the fragment's position in the source protein.
Most published work on BPC-157 comes from animal experiments rather than controlled human trials. Rodent models have examined its effects on gastrointestinal lesions, tendon and ligament injury, and blood vessel formation. These studies are often small and originate from a limited number of research groups, which affects how broadly the findings can be generalized. No large randomized human trial has been reported in the peer-reviewed literature. Discussion of the compound therefore rests largely on preclinical data, and questions about its effects in people remain open rather than settled.
Identity and purity are established using reversed-phase high-performance liquid chromatography, which separates the peptide from related impurities and yields a percentage purity. Mass spectrometry, typically with electrospray ionization, confirms the molecular mass against the expected value. Amino acid analysis or peptide mapping provides additional sequence confirmation. These methods are complementary, since chromatography measures how much material is present while mass spectrometry verifies what that material is. A certificate of analysis normally reports both.
Analytical results depend on the column, gradient, and detector wavelength chosen by the laboratory, so purity values from different sources are not always directly comparable. Water content, counterion form, and residual trifluoroacetate affect both mass and purity calculations. Microbiological and endotoxin testing are separate from chemical purity and are not covered by a standard chromatographic run. Buyers evaluating a material typically request the full method description rather than a single purity figure.
Lyophilized peptide powder is generally stored at minus twenty degrees Celsius or lower and kept away from light and moisture. Under these conditions degradation is slow, and sealed vials remain stable for extended periods. Once dissolved, the material is less stable, particularly in aqueous buffers near neutral pH, where hydrolysis and oxidation proceed faster. Solutions are usually kept cold and used within days to weeks. Repeated freeze-thaw cycles are avoided because they encourage aggregation.
In its usual supplied form, the peptide is a white to off-white lyophilized powder that dissolves readily in water and in aqueous buffers. Powder keeps far longer than solution, so material is normally shipped and stored dry, then dissolved only when needed. Once in solution, the chain is subject to hydrolysis and the liquid supports microbial growth, and practical guidance generally treats the dissolved form as short-lived. Containers should stay sealed and desiccated, because the powder takes up moisture from air.
Long-term storage of the dry powder is typically described at minus twenty degrees Celsius or colder, while shorter holding periods may use ordinary refrigeration. Repeated warming and cooling cycles are discouraged because they stress the material and can promote aggregation or loss. Light exposure and residual moisture are both treated as avoidable sources of degradation, and working aliquots are often prepared to limit how many times a container is opened. Sealed vials with a desiccant are the usual container.
Quality assessment rests on two separate questions: whether the chain is the intended one, and how much of the sample is that chain. Reverse-phase high-performance liquid chromatography with ultraviolet detection is the standard purity measurement, while mass spectrometry confirms identity through the observed molecular mass. Amino acid analysis and sequence verification provide further checks. A reported purity percentage describes the proportion of the sample represented by the main peak, not the amount of peptide by mass, since counter-ions and water make up part of any lyophilized lot.
BPC-157 is a synthetic pentadecapeptide with the sequence GEPPPGKPADDAGLV, corresponding to a partial fragment of a larger protein detected in human gastric juice. The name derives from the parent protein designation BPC, an abbreviation of body protection compound, with 157 acting as a fraction or batch identifier used by the original investigators. Its molecular weight is approximately 1419 daltons, and the chain contains no unusual residues or disulfide bridges. In the literature it is described as a short, water-soluble fragment rather than a complete natural protein.
Most early work on this peptide originated in the 1990s from a research group in Zagreb, Croatia, relying on animal models and cell cultures. Reported observations included effects on gastrointestinal lesion healing, tendon fibroblast migration, and blood vessel formation under controlled laboratory conditions. These findings come predominantly from rodent studies and in vitro assays rather than from human trials. Controlled human data remain limited, and the degree to which animal results translate to human physiology is an open question rather than a settled fact.
Within the research literature, the peptide is discussed through several provisional mechanisms, including cytoprotection, modulation of growth factor signaling, and interaction with the nitric oxide system. None of these mechanisms is fully characterized, and no single pathway is universally accepted. Review articles typically note the gap between consistent animal findings and sparse human evidence. The compound is classified as a research chemical rather than an approved pharmaceutical, which shapes how studies are designed, funded, and reported.
In 1887 Eddy started teaching a "metaphysical obstetrics" course, two one-week classes. She had started calling herself "Professor of Obstetrics" in 1882; McClure's wrote: "Hundreds of Mrs. Eddy's students were then practising who knew no more about obstetrics than the babes they helped into this world." The first prosecutions took place that year, when practitioners were charged with practicing medicine without a licence. All were acquitted during the trial, or convictions were overturned on appeal. The first manslaughter charge was in March 1888, when Abby H. Corner, a practitioner in Medford, Massachusetts, attended to her daughter during childbirth; the daughter bled to death and the baby did not survive. The defense argued that they might have died even with medical attention, and Corner was acquitted. To the dismay of the Christian Scientists' Association (the secretary resigned), Eddy distanced herself from Corner, telling the Boston Globe that Corner had only attended the college for one term and had never entered the obstetrics class. From then until the 1990s around 50 parents and practitioners were prosecuted, and often acquitted, after adults and children died without medical care; charges ranged from neglect to second-degree murder.
== Herbalism == A. mongholicus is used in traditional Chinese medicine (TCM). A. mongholicus is a component in Lectranal, a food supplement used in treatment of seasonal allergic rhinitis, though there is limited evidence of its effectiveness.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Long-term administration of spironolactone gives the histologic characteristic of "spironolactone bodies" in the adrenal cortex, which are eosinophilic, round, concentrically laminated cytoplasmic inclusions surrounded by clear halos in preparations stained with hematoxylin and eosin.
Sources: en.wikipedia.org
Chester Fisher died in 1965 at age 84. His sons maintained leadership of the company, with Aiken becoming Chairman and Benjamin becoming president. The youngest son, James Fisher, had the title Senior Vice President. Fisher Scientific Company issued its first public stock in 1965, and that year the company had $58 million in sales and close to a million customer transactions. In 1968 Fisher shares were listed on the New York Stock Exchange. In 1965 the company introduced the Differential Thermalyzer, a differential thermal analysis instrument. It acquired Pfeiffer Glass, Inc. in 1966, a manufacturer of high accuracy volumetric pipettes. The company released the Photometric Titralyzer that year, and a Hem-alyzer in 1968. In 1968, it purchased Massachusetts-based Jarrell-Ash Company, a producer of optical instrumentation, particularly for emission and atomic absorption spectroscopy. It acquired Chicago-based Stansi Scientific Company in 1967, expanding into educational science supplies. In 1976, Fisher Scientific established an Instrument Service Division. Fisher was acquired by Morristown, New Jersey–based Allied Corporation in 1981 for $330 million. At this time Benjamin R. Fisher was Chairman of the company, having gained the position in 1975 upon Aiken's retirement. Operating as a subsidiary of Allied Corporation (and later AlliedSignal Inc., and The Henley Group), Fisher established a Biotechnology Division in 1985. In 1991, The Henley Group sold a majority interest in Fisher through a public stock offering.
Accelerator mass spectrometry (AMS) is a form of mass spectrometry that accelerates ions to extraordinarily high kinetic energies before mass analysis. The special strength of AMS among the different methods of mass spectrometry is its ability to separate a rare isotope from an abundant neighboring mass ("abundance sensitivity", e.g. 14C from 12C). The method suppresses molecular isobars completely and in many cases can also separate atomic isobars (e.g. 14N from 14C). This makes possible the detection of naturally occurring, long-lived radio-isotopes such as 10Be, 36Cl, 26Al and 14C. (Their typical isotopic abundance ranges from 10−12 to 10−18.) AMS can outperform the competing technique of decay counting for all isotopes where the half-life is long enough. Other advantages of AMS include its short measuring time as well as its ability to detect atoms in extremely small samples.
==== Canada ==== 5-MAPB is not an explicitly listed controlled substance in the Controlled Drugs and Substances Act in Canada. However, it is an implicitly controlled substance in this country under the act's phenethylamine and amphetamine catch-all clauses, which bans amphetamines as well as phenethylamine benzofurans.
Sources: en.wikipedia.org
Israeli defense minister Yoav Gallant met with mayors and local council heads in Nahariya, northern Israel to discuss the threat of Hezbollah to northern residents. Gallant said that if diplomacy fails, Israel will use its military to force Hezbollah north of the Litani River. On 11 December, the mayor of the southern Lebanese village of Taybeh was killed in an Israeli airstrike. Two other Hezbollah fighters were killed by Israeli airstrikes and artillery shelling in Aitaroun, and three civilians were injured. Other airstrikes were carried out by the IAF, destroying five houses and damaging 17 others. Four batches of missiles fired from Lebanon towards northern Israel were intercepted by the Iron Dome defense system, while the Islamic Resistance claimed it attacked several Israeli sites. According to Israeli media, three soldiers were injured. Hezbollah and other militias attacked nine Israeli towns and military positions. Israeli war cabinet minister and former defense minister Benny Gantz discussed security in northern Israel in a phone call with US secretary of state Antony Blinken. Gantz said he conveyed that Hezbollah's heightened aggression and attacks mean that Israel must "remove" the threat from northern Israel. Gantz's statement singled out the Lebanese state, not just Hezbollah, and called for international pressure on Lebanon to stop attacks on its southern border. The Syrian Social Nationalist Party in Lebanon announced the death of one member of their military wing, the Eagles of the Whirlwind, on 15 December.
The time frame in question when dealing with radioactive waste ranges from 10,000 to 1,000,000 years, according to studies based on the effect of estimated radiation doses. Researchers suggest that forecasts of health detriment for such periods should be examined critically. Practical studies only consider up to 100 years as far as effective planning and cost evaluations are concerned. Long term behavior of radioactive wastes remains a subject for ongoing research projects in geoforecasting.
==== Russian Federation ==== According to a document received in response to an appeal to the Ministry of Internal Affairs of the Russian Federation, measures of state control in the Russian Federation regarding CBD have not been established. However, there is also a response from the Ministry of Health of the Russian Federation indicating that CBD can be considered as an isomer of restricted THC. The "isomer" argument is nonetheless vague, as progesterone, which is freely sold in pharmacies, is also an isomer of THC, all three being C21H30O2. On February 17, 2020, the deputy of the Moscow City Duma Darya Besedina sent an official request to the Prime Minister of the Russian Federation Mikhail Mishustin with a request to eliminate that legal ambiguity by publishing official explanations and, if necessary, making required changes in the corresponding government decree.
=== Skin and hair === Water-induced wrinkles are not caused by the skin absorbing water and swelling. They are caused by the autonomic nervous system, which triggers localized vasoconstriction in response to wet skin, yielding a wrinkled appearance. A person's hair and fingernails do not continue to grow after death. Rather, the skin dries and shrinks away from the bases of hairs and nails, giving the appearance of growth. Shaving does not cause terminal hair to grow back thicker or darker. This belief is thought to be due to the fact that hair that has never been cut has a tapered end, so after cutting, the base of the hair is blunt and appears thicker and feels coarser. The fact that short hairs are less flexible than longer hairs contributes to this effect. MC1R, the gene mostly responsible for red hair, is not becoming extinct, nor will the gene for blond hair do so, although both alleles are recessive. Redheads and blonds may become rarer but will not die out unless everyone who carries those alleles dies without passing their hair color genes on to their children. Acne is not caused by a lack of hygiene or eating fatty foods, though certain medications or a carbohydrate-rich diet may worsen it. Dandruff is not caused by poor hygiene, though infrequent hair-washing can make it more obvious. The exact causes of dandruff are uncertain, but they are believed to be mostly genetic and environmental factors.
Sources: en.wikipedia.org
The lyophilized powder is normally kept at minus twenty degrees Celsius or colder. Solutions are held at refrigerator temperature or below and protected from light. Repeated freezing and thawing is avoided because it can promote aggregation or loss of activity.
Reverse-phase liquid chromatography is used to assess purity, and mass spectrometry confirms molecular mass. Together these two checks form the most widespread approach. Some laboratories add amino acid analysis for further verification.
Yes. The peptide is freely soluble in water and in aqueous buffers, so reconstitution does not require an organic solvent. Stock solutions are usually prepared in water or a mild buffer. Exact handling depends on the intended downstream application.
Low temperature slows the chemical reactions, such as oxidation and hydrolysis, that break down a peptide chain. Water and oxygen are the main drivers of degradation, so a cold and dry environment extends usable life. Actual shelf life depends on the batch, the salt form, and the container.